Stem-loop sequence rgl-MIR5139

AccessionMI0018051 (change log)
DescriptionRehmannia glutinosa miR5139 stem-loop
Stem-loop
   a     a     acc   c       -  aagaggaauugaugaucuuuauucaugaaaagagagaacuauaua 
5'  guuau ucaaa   ugg ucugaua cc                                             u
    ||||| |||||   ||| ||||||| ||                                              
3'  cggug gguuu   acc agauuau gg                                             a
   a     -     -ca   -       u  gguauaacucuauuuuuaaagcagaagcuguauagcaacauauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR5139

Accession MIMAT0020650
Sequence

11 - 

aaaccuggcucugauacca

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21439075 "Differential miRNA expression in Rehmannia glutinosa plants subjected to continuous cropping" Yang Y, Chen X, Chen J, Xu H, Li J, Zhang Z BMC Plant Biol. 11:53(2011).