Stem-loop sequence bdi-MIR166e

AccessionMI0018112 (change log)
DescriptionBrachypodium distachyon miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention bdi-MIR166e
(16 sentences)

Stem-loop
   --------   aua   aagg        uuu     u          uu      cu      ---g  -         agaa 
5'         ggg   gca    gggagcuu   uacuu gaggggaaug  gucugg  cgaggu    cu gagaucgag    c
           |||   |||    ||||||||   ||||| ||||||||||  ||||||  ||||||    || |||||||||    u
3'         ucc   ugu    cccucgaa   augaa cuccccuuac  cggacc  gcucua    ga cucuagcuu    u
   ucuuagcg   -gg   ---g        ---     -          uu      ag      guua  u         aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 51437868-51438018 [+]
intergenic
Database links

Mature sequence bdi-miR166e-5p

Accession MIMAT0027063
Sequence

35 - 

ggaauguugucuggcucgagg

 - 55

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR166e-3p

Accession MIMAT0020687
Sequence

98 - 

cucggaccaggcuucauuccc

 - 118

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).