Stem-loop sequence bdi-MIR5182

AccessionMI0018155 (change log)
DescriptionBrachypodium distachyon miR5182 stem-loop
Stem-loop
   aauaggcacccccuaagcau   u      c  c     u         c ug                    g              auucaaaaguucauuugacuacaaaucu 
5'                     gua uaccuc gu cggau uauaaggca g  uguguuccaagaucaucgau uaacuagcaaaaua                            a
                       ||| |||||| || ||||| ||||||||| |  |||||||||||||||||||| ||||||||||||||                            a
3'                     cau auggag ca gccua auauuccgu c  gcacaagguucuaguaguua auugguuguuuuau                            u
   --------------------   c      c  u     u         a gu                    a              acauaauauaauguguuuuuucauguag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 51090546-51090760 [-]
intergenic
Database links

Mature sequence bdi-miR5182

Accession MIMAT0020731
Sequence

165 - 

ugaugaucuuggaacacgugc

 - 185

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).