Accession | MIMAT0020830 |
Description | dme-let-7-3p mature miRNA |
Hairpins | |
Sequence | CUAUACAAUGUGCUAGCUUUCU |
Evidence | not_experimental |
Database links |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0007552 metamorphosis |
ECO:0000270 expression pattern evidence used in manual assertion |
PMID:11900466 | |
involved_in | GO:0040034 regulation of development, heterochronic |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18559475 | |
involved_in | GO:0040034 regulation of development, heterochronic |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18571409 |