Stem-loop sequence dme-mir-1002

AccessionMI0005824 (change log)
DescriptionDrosophila melanogaster miR-1002 stem-loop
Gene family MIPF0000909; mir-1002
Stem-loop
   ua       ua  u        u -g      agg     uugau 
5'   gaaauua  ua uuaaguag g  auacaa   gcgau     a
     |||||||  || |||||||| |  ||||||   |||||     u
3'   uuuuagu  au aauucauc c  uauguu   cgcug     a
   ug       cg  c        - ag      --a     ugaaa 
Get sequence
Deep sequencing
10212 reads, 494 reads per million, 34 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 13747609-13747697 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-1002
dme-mir-968chr2L: 13747748-13747839 [-]
dme-mir-1002chr2L: 13747609-13747697 [-]
Database links

Mature sequence dme-miR-1002-5p

Accession MIMAT0005483
Previous IDsdme-miR-1002
Sequence

15 - 

uuaaguaguggauacaaagggcga

 - 38

Get sequence
Deep sequencing8207 reads, 34 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-1002-3p

Accession MIMAT0020864
Sequence

56 - 

gcauuguaugaccuacuuaacu

 - 77

Get sequence
Deep sequencing2004 reads, 21 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).