Stem-loop sequence dme-mir-978

AccessionMI0005835 (change log)
DescriptionDrosophila melanogaster miR-978 stem-loop
Gene family MIPF0000926; mir-978
Literature search

1 open access papers mention dme-mir-978
(1 sentences)

Stem-loop
   guug   ---      u       c    c      cu    uugcaa 
5'     gcg   gcacaa cugcaau uacg cacugg  uacg      u
       |||   |||||| ||||||| |||| ||||||  ||||       
3'     cgc   uguguu gacguua augc gugacc  gugc      c
   -aaa   aag      -       a    c      -u    uaaaag 
Get sequence
Deep sequencing
1152 reads, 113 reads per million, 30 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19561236-19561327 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-978
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
dme-mir-979chrX: 19561837-19561931 [+]
Database links

Mature sequence dme-miR-978-5p

Accession MIMAT0020875
Sequence

16 - 

ugcaaucuacgccacuggcuuacg

 - 39

Get sequence
Deep sequencing201 reads, 12 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-978-3p

Accession MIMAT0005494
Previous IDsdme-miR-978
Sequence

56 - 

uguccagugccguaaauugcag

 - 77

Get sequence
Deep sequencing911 reads, 27 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).