Stem-loop sequence osa-MIR2876

AccessionMI0013041 (change log)
DescriptionOryza sativa miR2876 stem-loop
Literature search

3 open access papers mention osa-MIR2876
(8 sentences)

Stem-loop
   uuuuugagg               c           a            auaauugcuccugagcuuguguuugucauaaauguuaguuguua 
5'          aaauugcuggcagca uguuuauauag aauuucuguaaa                                            c
            ||||||||||||||| ||||||||||| ||||||||||||                                            u
3'          uuuaacgaccguugu acaaguauauc uuaaggacauuu                                            g
   --------g               c           c            guucguucuuacaaaucccuuugaaaauuccuuucuuuguagau 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 17008975-17009155 [-]
intergenic
Database links

Mature sequence osa-miR2876-5p

Accession MIMAT0020949
Sequence

11 - 

aauugcuggcagcacuguuua

 - 31

Get sequence
Evidence experimental; Illumina [2]

Mature sequence osa-miR2876-3p

Accession MIMAT0013826
Previous IDsosa-miR2876
Sequence

151 - 

uuccuauaugaacacuguugc

 - 171

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).
2