Stem-loop sequence gma-MIR5041

AccessionMI0017920 (change log)
DescriptionGlycine max miR5041 stem-loop
Literature search

2 open access papers mention gma-MIR5041
(2 sentences)

Stem-loop
   agaaacuuaaaguuguuggugcuagcaccaaucaaguguccuuuc  c        a   u                         cacucaa 
5'                                              cg guucucga aac uucaucuucaacuugcucaacggua       g
                                                || |||||||| ||| |||||||||||||||||||||||||        
3'                                              gc caagggcu uug aaguagaaguugaacgaguugcuau       u
   ------------------------------------uaccuguaa  -        g   u                         acuaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 30479426-30479576 [+]
intergenic
Database links

Mature sequence gma-miR5041-5p

Accession MIMAT0021070
Previous IDsgma-miR5041
Sequence

61 - 

uuucaucuucaacuugcucaa

 - 81

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence gma-miR5041-3p

Accession MIMAT0032122
Sequence

107 - 

guugagcaaguugaagaugaa

 - 127

Get sequence
Evidence experimental; Illumina [2]

References

1
2