Stem-loop sequence gma-MIR5043

AccessionMI0017924 (change log)
DescriptionGlycine max miR5043 stem-loop
Stem-loop
   cgacgacgaccgccgcguucauguccauuucccacaaccuuaaaaccgg       u              c       cc   c 
5'                                                  cggcauc ugguguccccuucu ugcacca  cuu c
                                                    ||||||| |||||||||||||| |||||||  |||  
3'                                                  gccguag accacaggggaaga acguggu  gaa u
   --------------------auuccaacacccuguaauaaaugggaaga       u              u       -a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 46967498-46967648 [+]
intergenic
Database links

Mature sequence gma-miR5043

Accession MIMAT0021074
Sequence

61 - 

uguccccuucucugcaccacc

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1