Stem-loop sequence mtr-MIR5205a

AccessionMI0018240 (change log)
DescriptionMedicago truncatula miR5205a stem-loop
Literature search

1 open access papers mention mtr-MIR5205a
(1 sentences)

Stem-loop
   -uaugaaauac    aa   ca    -        c   gg   ga 
5'            ccaa  cau  uaca auuuggga gga  gag  a
              ||||  |||  |||| |||||||| |||  |||  g
3'            gguu  gua  gugu ugaauucu cuu  uuc  g
   uucaaaccuua    ga   ag    a        -   ag   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 21198741-21198832 [-]
intergenic
Database links

Mature sequence mtr-miR5205a

Accession MIMAT0021133
Sequence

20 - 

cauacaauuugggacggagggag

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).