Stem-loop sequence mtr-MIR5246

AccessionMI0018347 (change log)
DescriptionMedicago truncatula miR5246 stem-loop
Stem-loop
   ua  u      -ac    gaucu        a      
5'   gg aaaaca   acuu     ggcuguuu uaauu 
     || ||||||   ||||     |||||||| |||| u
3'   uc uuuugu   ugga     ucgacaga guuag 
   --  -      auu    -aguu        c      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 24009245-24009314 [-]
intergenic
chr8: 24180980-24181049 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5246
mtr-MIR399cchr8: 24182595-24182713 [-]
mtr-MIR5246chr8: 24180980-24181049 [-]
mtr-MIR399kchr8: 24176682-24176775 [-]
mtr-MIR399jchr8: 24173628-24173718 [+]
mtr-MIR399hchr8: 24167198-24167287 [-]
mtr-MIR399hchr8: 24050903-24050992 [+]
mtr-MIR399rchr8: 24012653-24012754 [+]
mtr-MIR399cchr8: 24010865-24010983 [-]
mtr-MIR5246chr8: 24009245-24009314 [-]
mtr-MIR399kchr8: 24004937-24005030 [-]
mtr-MIR399jchr8: 24001880-24001970 [+]
mtr-MIR399hchr8: 24000209-24000298 [-]
mtr-MIR399hchr8: 23153129-23153218 [+]
Database links

Mature sequence mtr-miR5246

Accession MIMAT0021242
Sequence

40 - 

uugcagacagcuuugaagguu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).