Stem-loop sequence mtr-MIR5260

AccessionMI0018364 (change log)
DescriptionMedicago truncatula miR5260 stem-loop
Stem-loop
   gucaacaaa            -  c   gcuuug     auuuaa  a  gaa 
5'          uuuuguauuguu ga aug      uugca      uc ag   a
            |||||||||||| || |||      |||||      || ||   u
3'          aaaacauaacaa cu uau      gacgu      ag uc   u
   -aacaaaca            u  u   ---aua     ------  c  aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 18805493-18805590 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5260
mtr-MIR5215chr8: 18805675-18805760 [-]
mtr-MIR5260chr8: 18805493-18805590 [-]
Database links

Mature sequence mtr-miR5260

Accession MIMAT0021260
Sequence

11 - 

uuuguauuguugacauggcuu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).