Stem-loop sequence mtr-MIR5261

AccessionMI0018365 (change log)
DescriptionMedicago truncatula miR5261 stem-loop
Stem-loop
   ---    gaaac    a   ucaa          a 
5'    caau     uagu caa    aucuacgaug a
      ||||     |||| |||    |||||||||| u
3'    guug     aucg guu    uagauguuac u
   uuu    ---ac    -   ucgg          u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 2262771-2262836 [+]
intergenic
Database links

Mature sequence mtr-miR5261

Accession MIMAT0021261
Sequence

36 - 

ucauuguagauggcuuuggcu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).