Stem-loop sequence rmi-mir-5318

AccessionMI0018499 (change log)
DescriptionRhipicephalus microplus miR-5318 stem-loop
Literature search

1 open access papers mention rmi-mir-5318
(1 sentences)

Stem-loop
   ---------accuuauauagcccacaaacaaugcc    auaacu    aa    ----uuucu  g 
5'                                    uugu      gcag  gacu         cc a
                                      ||||      ||||  ||||         ||  
3'                                    agca      cguc  cuga         gg a
   acgccuuuguuugauuagucaaaacacauacaaga    caauau    --    cucuacccc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5318

Accession MIMAT0021390
Sequence

27 - 

uuguauaacugcagaagacuuuucucc

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).