Stem-loop sequence rmi-mir-5330

AccessionMI0018512 (change log)
DescriptionRhipicephalus microplus miR-5330 stem-loop
Stem-loop
   ucgagg   a   u   a   ccu    ca     ---     cuc   c  cu  g 
5'       acg uag cgc cga   gagc  ucugc   ugggc   uau ac  cc a
         ||| ||| ||| |||   ||||  |||||   |||||   ||| ||  ||  
3'       ugu auc gug gcu   uucg  ggaug   acccg   gua ug  gg g
   ----gg   g   -   -   --c    -a     uua     uac   u  ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5330

Accession MIMAT0021403
Sequence

74 - 

caauuguaggagcuucucggug

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).