Stem-loop sequence asu-mir-92

AccessionMI0018561 (change log)
DescriptionAscaris suum miR-92 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention asu-mir-92
(3 sentences)

Stem-loop
   ----- a a  g        a u  uc    u   ucggaagc 
5'      g c ca ucaggccg g cg  ugca uau        a
        | | || |||||||| | ||  |||| |||        g
3'      c g gu aguccggc c gc  acgu aua        c
   acuug - c  g        c u  uc    u   acggcaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-92-5p

Accession MIMAT0021485
Previous IDsasu-miR-92*
Sequence

10 - 

aggccgagucgucugcauuauu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-92-3p

Accession MIMAT0021486
Previous IDsasu-miR-92
Sequence

51 - 

uauugcacucgucccggccuga

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).