Stem-loop sequence sbi-MIR5383

AccessionMI0018690 (change log)
DescriptionSorghum bicolor miR5383 stem-loop
Literature search

1 open access papers mention sbi-MIR5383
(2 sentences)

Stem-loop
   -------------------uggaccuauuuauaggccg     -  ca      c   a    ua 
5'                                       gccau ga  gagcuc ggc gaga  u
                                         ||||| ||  |||||| ||| ||||   
3'                                       cggug cu  uucgag ccg cucu  u
   auacggucugguggagccggucuaccgucacuugaucg     u  -a      -   c    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 43795826-43795935 [+]
intergenic
Database links

Mature sequence sbi-miR5383

Accession MIMAT0021681
Sequence

23 - 

augacagagcuccggcagagauau

 - 46

Get sequence
Evidence experimental; SOLiD [1]

References

1