Stem-loop sequence aca-mir-92a-1

AccessionMI0018891 (change log)
DescriptionAnolis carolinensis miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   uac            u   u       ug c  u 
5'    acagguugggau ggu gcaaugc  u ua g
      |||||||||||| ||| |||||||  | ||  
3'    uguccggcccug uca cguuaug  g au u
   -gu            u   -       gu u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343584.1: 108945-109012 [+]
sense
ENSACAT00000019100 ; aca-mir-92a-1-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-92a-1
aca-mir-17GL343584.1: 108264-108330 [+]
aca-mir-18aGL343584.1: 108387-108482 [+]
aca-mir-19aGL343584.1: 108526-108609 [+]
aca-mir-20aGL343584.1: 108689-108770 [+]
aca-mir-19bGL343584.1: 108832-108901 [+]
aca-mir-92a-1GL343584.1: 108945-109012 [+]
Database links

Mature sequence aca-miR-92a

Accession MIMAT0021993
Sequence

45 - 

uauugcacuugucccggccugu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).