Stem-loop sequence aca-mir-5398

AccessionMI0018900 (change log)
DescriptionAnolis carolinensis miR-5398 stem-loop
Stem-loop
   gu  g                    ca    cu    a 
5'   au gguccuucuguuaaucucgg  acug  uauu g
     || ||||||||||||||||||||  ||||  ||||  
3'   ua cuaggaagacaguuaggguc  ugac  guga u
   cc  g                    ac    ag    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 95943331-95943408 [-]
sense
ENSACAT00000001553 ; PKN2-201; intron 2
Database links

Mature sequence aca-miR-5398-5p

Accession MIMAT0022006
Sequence

13 - 

cuguuaaucucggcaacugc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5398-3p

Accession MIMAT0022007
Sequence

47 - 

acagucacugggauugacaga

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).