Stem-loop sequence aca-mir-5435b

AccessionMI0018968 (change log)
DescriptionAnolis carolinensis miR-5435b stem-loop
Stem-loop
   cag    a       u  c    a           gagg 
5'    aguc uucugga ga cuag aaauuccuaga    u
      |||| ||||||| || |||| |||||||||||    a
3'    ucag aggaccu cu gauc uuuaaggauuu    u
   acg    a       u  u    g           auac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 25825594-25825674 [+]
sense
ENSACAT00000013192 ; FAM81B-201; intron 6
Database links

Mature sequence aca-miR-5435b-3p

Accession MIMAT0022090
Sequence

14 - 

gaugaccuagaaaauuccuag

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5435b-5p

Accession MIMAT0022091
Sequence

49 - 

uaggaauuugcuaguucuucca

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).