Stem-loop sequence aca-mir-5466

AccessionMI0018974 (change log)
DescriptionAnolis carolinensis miR-5466 stem-loop
Stem-loop
   uua    u  --g                a      a  u 
5'    auga ag   uggaugaugggcaaag acugca aa a
      |||| ||   |||||||||||||||| |||||| || c
3'    ugcu uc   accuacuacccguuuc ugacgu uu u
   agg    c  aaa                c      c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL344051.1: 57194-57274 [-]
sense
ENSACAT00000001110 ; FBXL18-201; intron 4
Database links

Mature sequence aca-miR-5466

Accession MIMAT0022099
Sequence

12 - 

uggaugaugggcaaagaacugc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).