Stem-loop sequence osa-MIR5508

AccessionMI0019026 (change log)
DescriptionOryza sativa miR5508 stem-loop
Literature search

2 open access papers mention osa-MIR5508
(4 sentences)

Stem-loop
   gcu   g                    g   c        ggguaagaaggauuggccucugucuagugccucac 
5'    auu aacuagauggcugaucuggu ugg uuggcuuu                                   u
      ||| |||||||||||||||||||| ||| ||||||||                                   u
3'    uga uugaucuaccgacuagaccg acc aacugaag                                   u
   cuc   g                    a   a        aagguuugguccugucaucugucuuggcgucuucc 
Get sequence
Deep sequencing
69 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 638203-638355 [-]
intergenic
Database links

Mature sequence osa-miR5508

Accession MIMAT0022141
Sequence

11 - 

uagauggcugaucuggugugg

 - 31

Get sequence
Deep sequencing66 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).