Stem-loop sequence osa-MIR5544

AccessionMI0019065 (change log)
DescriptionOryza sativa miR5544 stem-loop
Stem-loop
   u   ug        -    c    a  uu   a   a   uuaauuuucuuacuaacaaaaucuuaccaugcuauagauuucagccucuuauucucauauucu 
5'  ugu  ugacacca uuuc auuu gu  uuc uac cca                                                               u
    |||  |||||||| |||| |||| ||  ||| ||| |||                                                                
3'  acg  acuguggu gaag ugag ca  aag aug ggu                                                               g
   g   ua        u    a    g  -c   -   a   uugcuacgagguucauagcuuguuguucuuguuggauaccuaaguguuccacguauuaaucuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 19334838-19335042 [+]
intergenic
Database links

Mature sequence osa-miR5544

Accession MIMAT0022180
Sequence

174 - 

agaacacggaguagaaguuggu

 - 195

Get sequence
Evidence experimental; Illumina [1]

References

1