Stem-loop sequence sbi-MIR5564b

AccessionMI0019097 (change log)
DescriptionSorghum bicolor miR5564b stem-loop
Gene family MIPF0001359; MIR5564
Stem-loop
   ----------------c  ga   a              u   -   -c  ---  g       
5'                  gg  gca uucgucgaacagcu gag gcg  gc   cg ccgggc 
                    ||  ||| |||||||||||||| ||| |||  ||   || ||||| a
3'                  cc  cgu aagcagcuugucga cuc cgc  cg   gc ggccca 
   cguaacggaccgcaccu  uc   -              c   a   ac  acu  g       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 58719513-58719617 [+]
intergenic
Database links

Mature sequence sbi-miR5564b

Accession MIMAT0022242
Sequence

6 - 

gcaauucgucgaacagcuuga

 - 26

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21907786 "Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum" Zhang L, Zheng Y, Jagadeeswaran G, Li Y, Gowdu K, Sunkar R Genomics. 98:460-468(2011).