Stem-loop sequence sbi-MIR5569

AccessionMI0019105 (change log)
DescriptionSorghum bicolor miR5569 stem-loop
Stem-loop
   ----------------------------  a            c                    a   ca  cu          ca  u  c            ----aa   auag    a 
5'                             gu ggcucauuauug augcuugaacuaugguaaaa uuu  ua  cauuggauca  ua aa uuaguuauagau      agc    auuu a
                               || |||||||||||| |||||||||||||||||||| |||  ||  ||||||||||  || || ||||||||||||      |||    |||| c
3'                             ca cugaguaauaac uacgaacuugauaccauuuu aaa  au  guaaccuagu  au uu aaucaauaucua      ucg    uaag a
   uaccaaguuaacaccauuuaaaaaauac  c            a                    c   ac  ag          uc  u  a            aauaaa   -aaa    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr5: 66192556-66192769 [+]
intergenic
Database links

Mature sequence sbi-miR5569

Accession MIMAT0022250
Sequence

11 - 

uauugcaugcuugaacuaugguaa

 - 34

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21907786 "Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum" Zhang L, Zheng Y, Jagadeeswaran G, Li Y, Gowdu K, Sunkar R Genomics. 98:460-468(2011).