Stem-loop sequence cel-mir-5595

AccessionMI0019159 (change log)
DescriptionCaenorhabditis elegans miR-5595 stem-loop
Stem-loop
   --           u       ca    aaaa  u 
5'   ucucuuuuuuc cgcaugc  ucuc    ca c
     ||||||||||| |||||||  ||||    ||  
3'   agagagaagag gugugcg  agag    gu g
   gc           -       ag    --cg  a 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 14399565-14399629 [-]
antisense
F26H11.2a ; F26H11.2a; intron 13
F26H11.2b ; F26H11.2b; intron 13
F26H11.2c ; F26H11.2c; intron 13
F26H11.2i ; F26H11.2i; intron 13
F26H11.2k ; F26H11.2k; intron 13
Database links

Mature sequence cel-miR-5595-5p

Accession MIMAT0022313
Sequence

1 - 

ucucuuuuuucucgcaugccaucu

 - 24

Get sequence
Deep sequencing9 reads, 6 experiments
Evidence not experimental

Mature sequence cel-miR-5595-3p

Accession MIMAT0022314
Sequence

43 - 

agagcguguggagaagagagacg

 - 65

Get sequence
Deep sequencing47 reads, 12 experiments
Evidence not experimental
Database links

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).