Stem-loop sequence cin-mir-5612

AccessionMI0019178 (change log)
DescriptionCiona intestinalis miR-5612 stem-loop
Stem-loop
   ---  u  gu  u  u    ua    uguu 
5'    ag ca  ug ug ugua  uaga    u
      || ||  || || ||||  ||||    u
3'    uc gu  ac ac acau  aucu    u
   uac  u  ug  c  u    --    ugaa 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1q: 6076844-6076901 [-]
intergenic
1q: 6084032-6084089 [-]
intergenic
Database links

Mature sequence cin-miR-5612-5p

Accession MIMAT0022351
Previous IDscin-miR-5612*
Sequence

1 - 

agucaguuguuguuguauauaga

 - 23

Get sequence
Deep sequencing9 reads, 1 experiments
Evidence not experimental

Mature sequence cin-miR-5612-3p

Accession MIMAT0022352
Previous IDscin-miR-5612
Sequence

37 - 

uauacaucaccaguugucucau

 - 58

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence not experimental

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).