Stem-loop sequence ath-MIR5635c

AccessionMI0019239 (change log)
DescriptionArabidopsis thaliana miR5635c stem-loop
Gene family MIPF0001283; MIR5635
Literature search

1 open access papers mention ath-MIR5635c
(1 sentences)

Stem-loop
   u      a                     a             u           auaacuaacaacuguuuucguccuuaaacca 
5'  ugaccc gccaaaucgacucaccguuaa acuucuuaacagc cuccuaacagc                               a
    |||||| ||||||||||||||||||||| ||||||||||||| |||||||||||                                
3'  acuggg cgguuuagcugaguggcaauu ugaggaauugucg gaggauugucg                               c
   a      c                     g             c           gcaauguuuuguaccggauugucgacaauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 13316754-13316927 [-]
intergenic
Database links

Mature sequence ath-miR5635c

Accession MIMAT0022428
Sequence

134 - 

uguuaaggaguguuaacggug

 - 154

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).