Stem-loop sequence ath-MIR5658

AccessionMI0019242 (change log)
DescriptionArabidopsis thaliana miR5658 stem-loop
Stem-loop
   agauga  a               agaaucaguaagaagcuucuuc 
5'       ug ugaugaugaugaaac                      u
         || |||||||||||||||                       
3'       ac acuacuacuacuuug                      u
   aaguug  c               guuagaaggaggaggaggauuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 18485438-18485531 [-]
intergenic
Database links

Mature sequence ath-miR5658

Accession MIMAT0022431
Sequence

3 - 

augaugaugaugaugaugaaa

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).