Stem-loop sequence ola-mir-187

AccessionMI0019478 (change log)
DescriptionOryzias latipes miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   -u   u gg   gc                      ccugcuu 
5'   ggu g  cca  ggcugcaacacaggacaugggu       c
     ||| |  |||  ||||||||||||||||||||||        
3'   ccg c  ggu  ccgacguuguguucugugcucg       u
   au   u ga   ga                      ccccucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
11: 7840464-7840550 [+]
intergenic
Database links

Mature sequence ola-miR-187

Accession MIMAT0022596
Sequence

14 - 

ggcugcaacacaggacau

 - 31

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).