Stem-loop sequence ola-mir-143

AccessionMI0019561 (change log)
DescriptionOryzias latipes miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

1 open access papers mention ola-mir-143
(3 sentences)

Stem-loop
   -------u gu   g    auc    cug   au g         g      ---ug   a 
5'         g  ucu gucc   ucug   ccc  g ugcagugcu caucuc     guc g
           |  ||| ||||   ||||   |||  | ||||||||| ||||||     |||  
3'         c  agg cggg   aggc   ggg  c augucacga guagag     uag u
   gucugacu ug   a    ---    --a   cu g         a      ucuga   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
ultracontig115: 5319909-5320017 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-143
ola-mir-143ultracontig115: 5319909-5320017 [+]
ola-mir-145ultracontig115: 5320131-5320190 [+]
Database links

Mature sequence ola-miR-143

Accession MIMAT0022668
Sequence

62 - 

ugagaugaagcacuguagcu

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).