Stem-loop sequence hvsa-miR-HSUR4

AccessionMI0019126 (change log)
DescriptionHerpesvirus saimiri strain A11 miR-HSUR4 stem-loop
Stem-loop
   ac         -  a       -  u  a 
5'   cguguugcu ac gcuauaa cu ca a
     ||||||||| || ||||||| || ||  
3'   gcacaacgg ug cgauauu ga gu c
   -u         g  a       u  c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvsa-miR-HSUR4-5p

Accession MIMAT0022684
Sequence

1 - 

accguguugcuacagcuauaa

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hvsa-miR-HSUR4-3p

Accession MIMAT0022685
Sequence

36 - 

uuuauagcagugggcaacacgu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21925386 "A primate herpesvirus uses the integrator complex to generate viral microRNAs" Cazalla D, Xie M, Steitz JA Mol Cell. 43:982-992(2011).