Stem-loop sequence sha-mir-200a

AccessionMI0019632 (change log)
DescriptionSarcophilus harrisii miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   aaagaucacggcaaggucaucagugcugcuccagccccguggcacgaagu   ---     g        -             c    uuuuu 
5'                                                   ggg   ccucu ugggcauc uuacuagacagug ugga     g
                                                     |||   ||||| |||||||| ||||||||||||| ||||     g
3'                                                   ccc   ggaga auuuguag aauggucugucac aucu     a
   -------------------------------------guggacggcccag   aag     a        c             a    uaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL849763.1: 162393-162542 [+]
intergenic
Clustered miRNAs
< 10kb from sha-mir-200a
sha-mir-200bGL849763.1: 160073-160222 [+]
sha-mir-200aGL849763.1: 162393-162542 [+]
Database links

Mature sequence sha-miR-200a

Accession MIMAT0022805
Sequence

101 - 

uaacacugucugguaacga

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).