Stem-loop sequence sha-mir-130b

AccessionMI0019642 (change log)
DescriptionSarcophilus harrisii miR-130b stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   aucuauuuuuucuuuaguaugauuggacaucuuauugac   g       --  u             u          a  ---a   au 
5'                                        uga ugguauu  ug cuagugcccuuuu auguuguacu cu    gug  c
                                          ||| |||||||  || ||||||||||||| |||||||||| ||    |||   
3'                                        acu gccauag  ac gguuacgggaaaa uguaacguga ga    cac  c
   -----------------------------gggucuuuac   g       ug  c             u          c  agaa   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL856812.1: 2852938-2853087 [+]
sense
ENSSHAT00000020932 ; SKA2-201; intron 1
Database links

Mature sequence sha-miR-130b

Accession MIMAT0022814
Sequence

101 - 

agugcaauguuaaaagggcau

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).