Stem-loop sequence sha-mir-25

AccessionMI0019648 (change log)
DescriptionSarcophilus harrisii miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ggggggggcauuagagcaggacucuucucccuua    -ccau   -gacug     ug   ag    g     uu g     u   g aca 
5'                                   cagg     cug      gccag  uug  aggc gagac  g gcaau gcu a   c
                                     ||||     |||      |||||  |||  |||| |||||  | ||||| ||| |   u
3'                                   gucc     gac      cgguc  gac  ucug cucug  c cguua cgg u   g
   ----------------------------------    uacac   acaaaa     gu   ag    g     uu a     -   g ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL856864.1: 888073-888222 [+]
sense
ENSSHAT00000013709 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from sha-mir-25
sha-mir-93GL856864.1: 887817-887966 [+]
sha-mir-25GL856864.1: 888073-888222 [+]
Database links

Mature sequence sha-miR-25

Accession MIMAT0022820
Sequence

101 - 

cauugcacuugucucgguc

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).