Stem-loop sequence sha-mir-141

AccessionMI0019654 (change log)
DescriptionSarcophilus harrisii miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   auagagaugcuuacugugauuggccagcucuggcccuggccgugc       u    c      --    u           ----     u 
5'                                              ccagcuc gggg caucuu  ccag gcaguguugga    ucgug a
                                                ||||||| |||| ||||||  |||| |||||||||||    |||||  
3'                                              gguuggg cccc guagaa  gguc ugucacaaucu    agugc a
   -----------------------------caguggcuucccucuu       c    c      au    -           ucga     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL861612.1: 2158436-2158585 [+]
intergenic
Clustered miRNAs
< 10kb from sha-mir-141
sha-mir-200cGL861612.1: 2158021-2158170 [+]
sha-mir-141GL861612.1: 2158436-2158585 [+]
Database links

Mature sequence sha-miR-141

Accession MIMAT0022826
Sequence

101 - 

uaacacugucugguaaagaug

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).