Stem-loop sequence ssc-mir-490-1

AccessionMI0015914 (change log)
Previous IDsssc-mir-490
DescriptionSus scrofa miR-490-1 stem-loop
Gene family MIPF0000229; mir-490
Literature search

2 open access papers mention ssc-mir-490-1
(2 sentences)

Stem-loop
   --uu        c      -   -      g   cac   u 
5'     guucgaca caugga ucc ccaggu ggu   guu c
       |||||||| |||||| ||| |||||| |||   |||  
3'     cgaguugu guaccu agg ggucca cca   uag a
   uugu        c      c   a      a   -ca   a 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 13361980-13362058 [-]
intergenic
Database links

Mature sequence ssc-miR-490-5p

Accession MIMAT0017959
Previous IDsssc-miR-490
Sequence

11 - 

ccauggauccccaggugggu

 - 30

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1-2]

Mature sequence ssc-miR-490-3p

Accession MIMAT0022960
Sequence

48 - 

caaccuggaggacuccaugcug

 - 69

Get sequence
Deep sequencing68 reads, 11 experiments
Evidence experimental; Illumina [2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).