Stem-loop sequence bra-MIR5715

AccessionMI0019326 (change log)
DescriptionBrassica rapa miR5715 stem-loop
Stem-loop
   guau           g        c         a     u g  ----    --c   a   aag  caagucgccagcugcuucaaaacaaagacc 
5'     uagaucauuac ugauaagc ucugaagaa gacgu g gc    cuuc   cuc guu   cu                              u
       ||||||||||| |||||||| ||||||||| ||||| | ||    ||||   ||| |||   ||                               
3'     aucuaguaaug gcuauucg agacuucuu cugca u cg    gaag   gag caa   ga                              g
   ----           g        a         -     - g  aaca    aaa   a   gaa  aaaggguaacugacucaaacaauggucaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 11797752-11797937 [+]
intergenic
Database links

Mature sequence bra-miR5715

Accession MIMAT0023012
Sequence

14 - 

acgugauaagccucugaagaa

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).