Stem-loop sequence bra-MIR1885b

AccessionMI0019329 (change log)
DescriptionBrassica rapa miR1885b stem-loop
Gene family MIPF0001505; MIR1885
Literature search

6 open access papers mention bra-MIR1885b
(13 sentences)

Stem-loop
   -     u     c  ua  c   c   c    c        u -u            c    u      a       c   -uaaaaaa          a          -          aau  a          agaaugauacugagcucuuacauucgauuagaugcgauaauc 
5'  uuguc cacaa ug  uc auc ugu uuca gagcuucc c  agaagaugugcg agag cuuucu agucaca uca        uucaaagaaa ggaaucauac uuucauugau   ga aucaauagag                                          u
    ||||| ||||| ||  || ||| ||| |||| |||||||| |  |||||||||||| |||| |||||| ||||||| |||        |||||||||| |||||||||| ||||||||||   || ||||||||||                                           
3'  aacag guguu ac  ag ugg aca aagu cucgaagg g  ucuucuacaugc ucuc gaaaga ucagugu agu        aaguuucuuu ccuuaguaug aaaguaacua   cu uaguuaucuc                                          u
   a     -     a  ca  a   a   a    a        c cc            a    c      a       a   uuucacua          c          g          cuu  c          cuacuagguaaccaguagucgagaauguucguuaaucuccua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bra-miR1885b

Accession MIMAT0023015
Sequence

302 - 

uacaucuucuccgcggaagcuc

 - 323

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).