Stem-loop sequence tur-mir-92

AccessionMI0019391 (change log)
DescriptionTetranychus urticae miR-92 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention tur-mir-92
(13 sentences)

Stem-loop
   - uc        u u ------      a        ua   u    u      -------u   u 
5'  g  cauuggaa c c      auacug aacaggcc  gac ggug caauau        uca a
    |  |||||||| | |      |||||| ||||||||  ||| |||| ||||||        ||| u
3'  c  gugauuuu g g      uauggc uuguccgg  cug ucac guuaua        agu u
   g uc        u u cuaauu      a        cc   c    -      cuacuauu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tur-miR-92-5p

Accession MIMAT0023086
Sequence

26 - 

aggccuagacuggugucaauauu

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tur-miR-92-3p

Accession MIMAT0023087
Sequence

69 - 

uauugcacucgucccggccugu

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22113690 "The genome of Tetranychus urticae reveals herbivorous pest adaptations" Grbic M, Van Leeuwen T, Clark RM, Rombauts S, Rouze P, Grbic V, Osborne EJ, Dermauw W, Ngoc PC, Ortego F, Hernandez-Crespo P, Diaz I, Martinez M, Navajas M, Sucena E, Magalhaes S, Nagy L, Pace RM, Djuranovic S, Smagghe G, Iga M, Christiaens O, Veenstra JA Nature. 479:487-492(2011).