Stem-loop sequence tur-mir-124-1

AccessionMI0019402 (change log)
DescriptionTetranychus urticae miR-124-1 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
          au     ------uu      -    cc             au    --     uu  c 
5' ucauguu  uguca        gccaua cucu  guguucacugugu  gucu  ugaug  uc u
   |||||||  |||||        |||||| ||||  |||||||||||||  ||||  |||||  ||  
3' aguacag  auagu        uggugu gaga  cguaaguggcgca  cgga  acuau  ag u
          gu     uauucuau      u    ac             --    au     -u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tur-miR-124-1-5p

Accession MIMAT0023088
Sequence

28 - 

cguguucacuguguaugucuug

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tur-miR-124-3p

Accession MIMAT0023089
Sequence

69 - 

uaaggcacgcggugaaugcca

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22113690 "The genome of Tetranychus urticae reveals herbivorous pest adaptations" Grbic M, Van Leeuwen T, Clark RM, Rombauts S, Rouze P, Grbic V, Osborne EJ, Dermauw W, Ngoc PC, Ortego F, Hernandez-Crespo P, Diaz I, Martinez M, Navajas M, Sucena E, Magalhaes S, Nagy L, Pace RM, Djuranovic S, Smagghe G, Iga M, Christiaens O, Veenstra JA Nature. 479:487-492(2011).