Stem-loop sequence mtr-MIR5754

AccessionMI0019681 (change log)
DescriptionMedicago truncatula miR5754 stem-loop
Stem-loop
   ----ugg   aa    u   ug ug   a          a   u       --u   uu u   u 
5'        gau  agau cca  a  agu uauugcacuc ucu ccauggc   guu  c ucc c
          |||  |||| |||  |  ||| |||||||||| ||| |||||||   |||  | ||| c
3'        cua  ucua ggu  u  uca auaacgugag aga gguaccg   uaa  g agg a
   agaacag   --    u   gu gu   a          a   -       ugu   cu u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 24463751-24463874 [-]
intergenic
Database links

Mature sequence mtr-miR5754

Accession MIMAT0023136
Sequence

26 - 

uauugcacucaucuuccauggc

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).