Stem-loop sequence mtr-MIR2593d

AccessionMI0019699 (change log)
DescriptionMedicago truncatula miR2593d stem-loop
Gene family MIPF0000875; MIR2593
Stem-loop
   u     c      a                        g   aua 
5'  uuuga uuuuag uucauucaaucgaugauguaugug uuc   u
    ||||| |||||| |||||||||||||||||||||||| |||    
3'  aaacu aaaauc aaguaaguuaguuacuacauacac gag   u
   -     a      c                        -   aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 8822043-8822132 [-]
intergenic
Database links

Mature sequence mtr-miR2593d

Accession MIMAT0023154
Sequence

57 - 

auacaucauugauugaaugaaccu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).