Stem-loop sequence osa-MIR5792

AccessionMI0019804 (change log)
DescriptionOryza sativa miR5792 stem-loop
Literature search

3 open access papers mention osa-MIR5792
(4 sentences)

Stem-loop
            c         ucgga    uuc    uu  a 
5' cgucgauga agcgguggu     cauc   ggcu  gu c
   ||||||||| |||||||||     ||||   ||||  ||  
3' guagcuauu uugcuacua     guag   ucgg  cg c
            c         ---cg    --u    uu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 11842884-11842960 [+]
intergenic
Database links

Mature sequence osa-miR5792

Accession MIMAT0023259
Sequence

5 - 

gaugacagcggugguucggacauc

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).