Stem-loop sequence hco-mir-5892a

AccessionMI0020007 (change log)
DescriptionHaemonchus contortus miR-5892a stem-loop
Gene family MIPF0001539; mir-5892
Stem-loop
   uaacg   cuuccg     -    u   c                     c  ---  g 
5'      agc      guccu gaag uug ucagaugauccagauguuagu gc   cc c
        |||      ||||| |||| ||| ||||||||||||||||||||| ||   ||  
3'      ucg      uagga cuuc agc agucuacuagguuuacaauua cg   gg a
   gcuua   ------     g    u   a                     a  aaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5892a

Accession MIMAT0023331
Sequence

66 - 

aauuaacauuuggaucaucugaa

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).