Stem-loop sequence hco-mir-5897a

AccessionMI0020017 (change log)
DescriptionHaemonchus contortus miR-5897a stem-loop
Stem-loop
   ------ugg     u      cu     c      -u            --    a 
5'          ucaag gagcgg  gucau ucuaga  gguuguacaaag  uccc u
            ||||| ||||||  ||||| ||||||  ||||||||||||  ||||  
3'          aguuc cucguu  uagua agaucu  ucaauauguuuu  aggg a
   uccacagag     -      --     a      uc            gg    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5897a

Accession MIMAT0023341
Sequence

57 - 

uuuuguauaacucuucuagaaau

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).