Stem-loop sequence hco-mir-5908

AccessionMI0020036 (change log)
DescriptionHaemonchus contortus miR-5908 stem-loop
Literature search

1 open access papers mention hco-mir-5908
(1 sentences)

Stem-loop
   ------agucccagc        u    -c        -u  a            g 
5'                guucaguc aaug  gaugauug  gc cuggugagguac a
                  |||||||| ||||  ||||||||  || |||||||||||| a
3'                caagucag uuac  cuacugac  cg gacuacuucaug u
   agacguacuucgcuu        c    au        uc  -            g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5908-5p

Accession MIMAT0023362
Sequence

24 - 

gaugauugugcacuggugagg

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hco-miR-5908-3p

Accession MIMAT0023363
Sequence

57 - 

uucaucaggccucagucaucuacau

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).