Stem-loop sequence hco-mir-5897b

AccessionMI0020037 (change log)
DescriptionHaemonchus contortus miR-5897b stem-loop
Gene family MIPF0001517; mir-5897
Stem-loop
   cacuauaa     --uu      ga   u    c        u          u  ga u 
5'         uuugc    ggguug  gau cagu ccagauaa gcguacaaag cc  c a
           |||||    ||||||  ||| |||| |||||||| |||||||||| ||  |  
3'         agacg    uccaac  cua guua ggucuauu cguauguuuu gg  g u
   -------a     uauu      -a   -    a        c          -  ag a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5897b

Accession MIMAT0023364
Sequence

67 - 

uuuuguaugccuuaucuggaau

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).