Stem-loop sequence hco-mir-5909

AccessionMI0020038 (change log)
DescriptionHaemonchus contortus miR-5909 stem-loop
Stem-loop
   ----    -uu    uu a    a   g                     cug 
5'     agcu   ggag  g uuga gga aagaauggagaguugcaggag   a
       ||||   ||||  | |||| ||| |||||||||||||||||||||    
3'     uugg   ccuc  c gacu ccu uucuuacuucucaacgucuuc   g
   uauu    uuu    -u -    g   g                     cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5909

Accession MIMAT0023365
Sequence

55 - 

ucugcaacucuucauucuuguc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).