Stem-loop sequence hco-mir-5910

AccessionMI0020039 (change log)
DescriptionHaemonchus contortus miR-5910 stem-loop
Stem-loop
   uccaagc    c         -  a  ga     -  u 
5'        gugc uccccaauu cg uc  ggcga gu c
          |||| ||||||||| || ||  ||||| ||  
3'        uacg agggguuga gc ag  ccgcu ca a
   agucuua    a         a  -  ac     a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5910

Accession MIMAT0023366
Sequence

11 - 

ccuccccaauucgaucgaggcga

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).